loxl3a

Ensembl ID:
ENSDARG00000076306
ZFIN ID:
ZDB-GENE-070818-2
Description:
Lysyl oxidase-like 3a [Source:UniProtKB/TrEMBL;Acc:A6MH32]
Human Orthologue:
LOXL3
Human Description:
lysyl oxidase-like 3 [Source:HGNC Symbol;Acc:13869]
Mouse Orthologue:
Loxl3
Mouse Description:
lysyl oxidase-like 3 Gene [Source:MGI Symbol;Acc:MGI:1337004]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22418 Nonsense Mutation detected in F1 DNA During 2014
sa4548 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054866 Nonsense 314 739 6 14
Genomic Location:
Chromosome 14 (position 5897728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCAAGGGCAGGAGAGGGCCGTGTGGAGGTCCTGAAGGGCAGCGAGTG[G/A]GGTACAGTGTGTGACGACCACTGGAACCTGCAGTCTGCCAGTGTGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054866 Essential Splice Site 716 739 14 14
Genomic Location:
Chromosome 14 (position 5873137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTGTCATCAATTTACCATTTAACTCGTGTTATTTACGTTTTGTTTA[G/A]GTGATTCTTTCAGTGAGGAGGCCGAGAAAGAGTTTGAACATTATCCCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lug0ki71