NP_001120780.1

Ensembl ID:
ENSDARG00000076302
Description:
deltex1 [Source:RefSeq peptide;Acc:NP_001120780]
Human Orthologue:
DTX4
Human Description:
deltex homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:29151]
Mouse Orthologue:
Dtx4
Mouse Description:
deltex 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2672905]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34029 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111636 Essential Splice Site 417 704 4 9
Genomic Location (Zv9):
Chromosome 7 (position 19780206)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18313235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGTGAAGAACTTAAATGGATCCAGTCCTGTTCATCCCGCTCTGGCAG[G/T]TGAGAAACGATATGCAAATAGGGTATAAATAGTGGCTTTGATGATTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link