nfatc3

Ensembl ID:
ENSDARG00000076297
Human Orthologue:
NFATC3
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc3
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1320 Nonsense Available for shipment Available now
sa966 Nonsense Available for shipment Available now
sa34119 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073397 Nonsense 438 1074 3 10
Genomic Location (Zv9):
Chromosome 7 (position 36345494)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34619337
KASP Assay ID:
554-1234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAGCATCGAATCTGCCTCCCCTGGACTGGCCGTTGCCAAATCAGTA[T/A]GGGCAGTATGAGCTAAAGATCGAGGTTCAACCTAAAGCACATCACAGAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073397 Nonsense 829 1074 9 10
Genomic Location (Zv9):
Chromosome 7 (position 36304844)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34578687
KASP Assay ID:
554-0871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGCCATCTTACCCCCCCATACAGCACAACATGCCCTTCAATGGCCAG[C/T]AGAGTCTTCCTATGACTGCAGGCTCCCCACAGGCCTACGAGCGGATGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073397 Essential Splice Site 1049 1074 9 10
Genomic Location (Zv9):
Chromosome 7 (position 36304182)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34578025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCCACCTTCCGCACCATTGGCCTTCAGGACATAACACTTGATGATGG[T/G]GAGTCTTTTTACTTTATTAAACAATGTATTTTCATTCTTATGACACTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link