LOC796269

Ensembl ID:
ENSDARG00000076294
Human Orthologue:
KLB
Human Description:
klotho beta [Source:HGNC Symbol;Acc:15527]
Mouse Orthologue:
Klb
Mouse Description:
klotho beta Gene [Source:MGI Symbol;Acc:MGI:1932466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5869 Nonsense Mutation detected in F1 DNA During 2016
sa8655 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 14 750 2 7
Genomic Location (Zv9):
Chromosome 14 (position 742159)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 724990
KASP Assay ID:
554-3772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCSCTCTCTGTCTCCTCAGGCTCATGCTAAGGCGTATYACGTCTA[T/G]GATAAACTCTTCAGAGCTCRTCAGAATGGTAAAGTGTCCATCAGTCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 456 750 4 7
Genomic Location (Zv9):
Chromosome 14 (position 745865)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 728696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTCGCACGACATCTGYTGCTGGCGCATGCGAAAGCCTGGCGTGCTTA[T/A]GATGTGTATTTTCGCAAACAGCAGGGGGCGACGGTGAGTTTGGCGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link