LOC796269

Ensembl ID:
ENSDARG00000076294
Human Orthologue:
KLB
Human Description:
klotho beta [Source:HGNC Symbol;Acc:15527]
Mouse Orthologue:
Klb
Mouse Description:
klotho beta Gene [Source:MGI Symbol;Acc:MGI:1932466]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5869 Nonsense Mutation detected in F1 DNA During 2014
sa19071 Nonsense Mutation detected in F1 DNA During 2014
sa8655 Nonsense Mutation detected in F1 DNA During 2014
sa4538 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 14 750 2 7
Genomic Location:
Chromosome 14 (position 742159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCSCTCTCTGTCTCCTCAGGCTCATGCTAAGGCGTATYACGTCTA[T/G]GATAAACTCTTCAGAGCTCRTCAGAATGGTAAAGTGTCCATCAGTCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 374 750 4 7
Genomic Location:
Chromosome 14 (position 745619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCGGAGAGGGATCCAGCCAGTCGTGACTCTTTATCACCCCAGCTA[C/A]AGGTCTTCATCTCTGGGTTTACCTGAAGCGCTGCATGCTAACGGCGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 456 750 4 7
Genomic Location:
Chromosome 14 (position 745865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTCGCACGACATCTGYTGCTGGCGCATGCGAAAGCCTGGCGTGCTTA[T/A]GATGTGTATTTTCGCAAACAGCAGGGGGCGACGGTGAGTTTGGCGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110511 Nonsense 592 750 4 7
Genomic Location:
Chromosome 14 (position 746273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTACCCTGGGGGCTMYGCAGGATGCTGGGATGGGTGAAGAATCGCTA[T/A]GGCAACCGCCTCCCCATCATTATCACYGCATCAGGAGTGGAYGATCAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pjjtb9fi