tenc1a

Ensembl ID:
ENSDARG00000076292
ZFIN ID:
ZDB-GENE-090312-163
Human Orthologue:
TENC1
Human Description:
tensin like C1 domain containing phosphatase (tensin 2) [Source:HGNC Symbol;Acc:19737]
Mouse Orthologue:
Tenc1
Mouse Description:
tensin like C1 domain-containing phosphatase Gene [Source:MGI Symbol;Acc:MGI:2387586]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24264 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5031 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9651 Essential Splice Site Available for shipment Available now
sa24265 Nonsense Mutation detected in F1 DNA During 2014
sa15643 Nonsense Available for shipment Available now
sa24266 Nonsense Mutation detected in F1 DNA During 2014
sa24267 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24268 Nonsense Available for shipment Available now
sa14552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Essential Splice Site 112 1606 5 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 Essential Splice Site 93 429 6 17
Genomic Location:
Chromosome 23 (position 10656628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTGCAGCGAAGGGGAACATCCTCCTCTAGACACATTCAGCATCTGG[T/C]AAGATCTTTTTTTTTCTCTCCTTTATTATCTCTCCCATTAAATGACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Essential Splice Site 248 1606 9 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 Essential Splice Site 229 429 10 17
Genomic Location:
Chromosome 23 (position 10666416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACTGGCTGAACTCTGACCYCCAGCATGTGGTCGTTCTGCACTGTAAGG[T/G]CAGAGGTCACAGTCTTTGGACAGTTCATGTCAGGGTCACTTGTTTTYGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Essential Splice Site 356 1606 13 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 Essential Splice Site 339 429 14 17
Genomic Location:
Chromosome 23 (position 10669368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGAAGATCTATCAGTCCATGCAGCTTGTCTATACTTCTGGCATATAG[T/A]GAGTGAACRTTTTCTCWTTWTTAAAAGCANNNNTAGAGGTATTTGCTTGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Nonsense 548 1606 18 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10674629)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTTGTCTGTTAGCACTGATTCCGGACACTCATCTGTTCCTCCTGAT[C/T]GACTCGATGAACCGACTCGACCGGCCCCGCCTACTCAGCAAGAGAGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Nonsense 729 1606 18 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10675174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYAGTCTGYCCCCCCGACTGCTYTGTAGRCCAGATGAGTACATTTCATA[T/G]CCTCACCATCATCACAATCATTCACACCATCCCAAACCCAGCGGASCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Nonsense 847 1606 18 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10675527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGAGATGCAGAACTACAGTGGGAGAGAGAACGTGAGGCTGAATACT[G/A]GCACAGAAGGGCTACTGTATCCCCATACGGGCCCCACGGTCATGAATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Essential Splice Site 1022 1606 19 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10676225)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCTCCAACACCAGTCCACACAAGCAGCCCTTTACGAACCCAGGAAAG[G/A]TAATGTGCAGCTGCATTTATCAGTAGATCAACCACCGGAACCTTGACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Nonsense 1064 1606 20 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10676541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGCATCCAGCTACCATACAGCCCAACATGACCAATGCAGGATCACGG[C/T]AAACTCTACTCTCTTCCAGTCCAGAGACTCCTGAGATTAACCCGCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112445 Nonsense 1351 1606 20 27
ENSDART00000135594 None None 219 None 7
ENSDART00000140557 None None 429 None 17
Genomic Location:
Chromosome 23 (position 10677402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATTTGTGCAGGACAGCTCACGATTTTGGTATAAACCTGGCATCTCC[A/T]GAGAGCAAGGTGAGACAACSAATGTGGYCTATTTAWTCTAAACTACTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r717aqki