ENSDARG00000076287

Ensembl ID:
ENSDARG00000076287
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11320 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110315 Nonsense 309 475 1 2
ENSDART00000112823 Nonsense 456 623 4 5
Genomic Location:
Chromosome 8 (position 47282158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGTGGGCTTCTTTAACCAAGTGCTCGACTGTGCCATTCGTTCTGTT[G/T]WAGAGCGCTTTTCCCTGYTTCGAGATCACGGGCACGTATTTGGATTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h8t06uu2