KCNH7 (1 of 2)

Ensembl ID:
ENSDARG00000076281
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Human Orthologue:
KCNH7
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Mouse Orthologue:
Kcnh7
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31750 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114016 Essential Splice Site 166 253 2 3
Genomic Location (Zv9):
Chromosome 9 (position 52445888)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51077498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTTCCAGCATTCCTGGACCTACACCAACGGCATCGACATGAACATG[G/A]TGCGTCTACTCACTGTAATTACTGACAACACTGTAAAAACACTGTAGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link