adamts13

Ensembl ID:
ENSDARG00000076270
ZFIN ID:
ZDB-GENE-070814-7
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAM
Human Orthologue:
ADAMTS13
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 13 [Source:HGNC Symbol;Acc:1366]
Mouse Orthologue:
Adamts13
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5819 Nonsense F2 line generated During 2014
sa16863 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5819
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110085 None None 1332 None 32
ENSDART00000110310 Nonsense 705 1318 20 33
ENSDART00000142300 None None 357 None 9
ENSDART00000146364 None None 400 None 9
Genomic Location:
Chromosome 8 (position 47273256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAATAAACACAGGTTATCAGCTCCTTTAACATCTTCACAATGCACCTG[C/A]ACTCTGGACAGATGCTGTCTTTAAGGCCGTACTCACACTAGGYACAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110085 Essential Splice Site 1159 1332 29 32
ENSDART00000110310 Essential Splice Site 1152 1318 30 33
ENSDART00000142300 None None 357 None 9
ENSDART00000146364 None None 400 None 9
Genomic Location:
Chromosome 8 (position 47288415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGTYATTCAAATCARAATTATTTCCAGTACCCTTAACTGCCAGCAAA[G/A]TAAGTGCTAATCTTTCATTGCTTACAGACAGGGGAATCTGTAATAGCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coagulation factor levels: Linkage analysis identifies a locus for plasma von Willebrand factor undetected by genome-wide association. (View Study)
  • Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pgsv86xy