C9orf172 (1 of 2)

Ensembl ID:
ENSDARG00000076268
Description:
chromosome 9 open reading frame 172 [Source:HGNC Symbol;Acc:37284]
Human Orthologue:
C9orf172
Human Description:
chromosome 9 open reading frame 172 [Source:HGNC Symbol;Acc:37284]
Mouse Orthologue:
Gm996
Mouse Description:
predicted gene 996 Gene [Source:MGI Symbol;Acc:MGI:2685842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5280 Nonsense Mutation detected in F1 DNA During 2014
sa15509 Essential Splice Site Available for shipment Available now
sa12476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111759 Nonsense 308 991 4 7
Genomic Location:
Chromosome 5 (position 5495691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGMGGACTTAGGGAAGTATGGATCTTCAGCGCCATCAAGGACTTATTAT[C/T]AAGATGACCGATACAGCATTCCTAGCCAACCCTACTCACCTAAGGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111759 Essential Splice Site 321 991 4 7
Genomic Location:
Chromosome 5 (position 5495650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATTATYAAGATGACCGATACAGCATTCCTAGCCAACCCTACTCACC[T/G]AAGGTACAATATGTACAGGWTCCAAGGACTCACATTGTTCATACTGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111759 Nonsense 622 991 6 7
Genomic Location:
Chromosome 5 (position 5494632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCGATTACAAACCTCCAGCTAGGAGGACCAGCGAAGATTTGCTTGAT[C/T]AACTCAAAAAGCTGATTGATGAAGAAGAAGCKGWATCTTCAGCAAGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l6e8zwqg