pou3f2

Ensembl ID:
ENSDARG00000076262
ZFIN ID:
ZDB-GENE-980526-370
Description:
POU domain, class 3, transcription factor 2 [Source:UniProtKB/Swiss-Prot;Acc:P79746]
Human Orthologue:
POU3F2
Human Description:
POU class 3 homeobox 2 [Source:HGNC Symbol;Acc:9215]
Mouse Orthologue:
Pou3f2
Mouse Description:
POU domain, class 3, transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:101895]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22889 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093250 Nonsense 283 378 1 1
Genomic Location (Zv9):
Chromosome 16 (position 34875178)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32606678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAAGTGGTTGGAGGAGGCAGACTCCACATCTGGAAGCCCCACGAGCT[T/A]GGACAAGATAGCAGCGCAGGGGAGGAAACGGAAAAAGAGGACTTCCATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link