si:ch73-275j21.1

Ensembl ID:
ENSDARG00000076250
ZFIN ID:
ZDB-GENE-081105-157
Description:
Novel protein similar to H.sapiens RASEF, RAS and EF-hand domain containing (RASEF) [Source:UniProtK
Human Orthologue:
RASEF
Human Description:
RAS and EF-hand domain containing [Source:HGNC Symbol;Acc:26464]
Mouse Orthologue:
Rasef
Mouse Description:
RAS and EF hand domain containing Gene [Source:MGI Symbol;Acc:MGI:2448565]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21388 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108613 Splice Site, Nonsense 284 706 6 17
Genomic Location (Zv9):
Chromosome 8 (position 51850485)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49600872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGACTCTCTGAAGAGTGATCTGACAGACCAGAGCATCAACTGTGAA[C/T]GGTACAGTGTGTGTGAGTGTGTCACTACGCGAGTCAACTTAGTTAATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link