LOC567375

Ensembl ID:
ENSDARG00000076248
Human Orthologue:
PPP1R3D
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3D [Source:HGNC Symbol;Acc:9294]
Mouse Orthologue:
Ppp1r3d
Mouse Description:
protein phosphatase 1, regulatory subunit 3D Gene [Source:MGI Symbol;Acc:MGI:1917664]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7657 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112733 Nonsense 76 297 1 1
Genomic Location:
Chromosome 11 (position 1376806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACAGGATGCTGTGATCCGCCGCCGACTGTCCTGCGAACCCGAGCCC[A/T]AACCCATCATGAGGAGAAGAGCCAAATCCCTCTCGTCCTCCAGCGACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rbdnokwk