si:ch211-117c8.3

Ensembl ID:
ENSDARG00000076247
ZFIN ID:
ZDB-GENE-081107-4
Description:
Novel protein similar to vertebrate delta-like 2 homolog (Drosophila) (DLK2) [Source:UniProtKB/TrEMB
Human Orthologue:
DLK2
Human Description:
delta-like 2 homolog (Drosophila) [Source:HGNC Symbol;Acc:21113]
Mouse Orthologue:
Dlk2
Mouse Description:
delta-like 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2146838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17360 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113986 Essential Splice Site 100 378 4 5
ENSDART00000134105 Essential Splice Site 67 345 3 4
Genomic Location (Zv9):
Chromosome 13 (position 3863070)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4079990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACATTGTRGATTTTGAYTTCATGTTAAAAGACMGTGACTCTTTCCGC[A/T]GATGTTTACGTGTGCTCCAGACAGCAGCCGTGTCATAACGGGRCCACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link