txlnbb

Ensembl ID:
ENSDARG00000076241
ZFIN ID:
ZDB-GENE-070424-77
Description:
taxilin beta b [Source:RefSeq peptide;Acc:NP_001077022]
Human Orthologue:
TXLNB
Human Description:
taxilin beta [Source:HGNC Symbol;Acc:21617]
Mouse Orthologue:
Txlnb
Mouse Description:
taxilin beta Gene [Source:MGI Symbol;Acc:MGI:2671945]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa80 Nonsense Confirmed mutation in F2 line During 2014
sa4692 Nonsense Mutation detected in F1 DNA During 2014
sa6458 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa80
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026106 Nonsense 21 520 1 9
ENSDART00000115389 Nonsense 8 340 3 11
ENSDART00000137389 Nonsense 21 353 3 11
Genomic Location:
Chromosome 17 (position 6136400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTGTGCTCAATCTGCAAACGGAGAAATGACGGAGGATCTGTCTCAG[C/T]AGCTACAGGAGATCATCAACACATACCAGCTGAACGAACAGAAGCACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026106 Nonsense 34 520 1 9
ENSDART00000115389 Nonsense 21 340 3 11
ENSDART00000137389 Nonsense 34 353 3 11
Genomic Location:
Chromosome 17 (position 6136361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTCTCAGCAGCTRCAGGAGATCATCAACACATACCAGCTGAACGAA[C/T]AGAAGCACGAAACCGAGGAGGACGAGATGGAGGAGGAAGAGGAGGAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026106 Essential Splice Site 314 520 7 9
ENSDART00000115389 Essential Splice Site 301 340 9 11
ENSDART00000137389 Essential Splice Site 314 353 9 11
Genomic Location:
Chromosome 17 (position 6127912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTAAGAGTAATGGTGTTTATGCCAGCTTCAAACAGGAYATGGACAAGG[T/C]GTGTATCCACAGYACATTACAGGTTATTCTTTTAGAGGTTAAAAKGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1knvwgqk