txlnbb

Ensembl ID:
ENSDARG00000076241
ZFIN ID:
ZDB-GENE-070424-77
Description:
taxilin beta b [Source:RefSeq peptide;Acc:NP_001077022]
Human Orthologue:
TXLNB
Human Description:
taxilin beta [Source:HGNC Symbol;Acc:21617]
Mouse Orthologue:
Txlnb
Mouse Description:
taxilin beta Gene [Source:MGI Symbol;Acc:MGI:2671945]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa80 Nonsense Confirmed mutation in F2 line During 2016
sa6458 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa80
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026106 Nonsense 21 520 1 9
ENSDART00000115389 Nonsense 8 340 3 11
ENSDART00000137389 Nonsense 21 353 3 11
Genomic Location (Zv9):
Chromosome 17 (position 6136400)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6215336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTGTGCTCAATCTGCAAACGGAGAAATGACGGAGGATCTGTCTCAG[C/T]AGCTACAGGAGATCATCAACACATACCAGCTGAACGAACAGAAGCACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026106 Essential Splice Site 314 520 7 9
ENSDART00000115389 Essential Splice Site 301 340 9 11
ENSDART00000137389 Essential Splice Site 314 353 9 11
Genomic Location (Zv9):
Chromosome 17 (position 6127912)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6206848
KASP Assay ID:
554-4974.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTAAGAGTAATGGTGTTTATGCCAGCTTCAAACAGGAYATGGACAAGG[T/C]GTGTATCCACAGYACATTACAGGTTATTCTTTTAGAGGTTAAAAKGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link