CHL1 (1 of 2)

Ensembl ID:
ENSDARG00000076233
Description:
cell adhesion molecule with homology to L1CAM (close homolog of L1) [Source:HGNC Symbol;Acc:1939]
Human Orthologue:
CHL1
Human Description:
cell adhesion molecule with homology to L1CAM (close homolog of L1) [Source:HGNC Symbol;Acc:1939]
Mouse Orthologue:
Chl1
Mouse Description:
cell adhesion molecule with homology to L1CAM Gene [Source:MGI Symbol;Acc:MGI:1098266]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11246 Nonsense Available for shipment Available now
sa15944 Essential Splice Site Available for shipment Available now
sa10607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111855 Nonsense 22 1253 1 28
Genomic Location:
Chromosome 6 (position 44851051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACCCTGCTTCTTTTGGCTGCTTGCCTYAATATGAKCAGCAGGTAT[C/T]AAACTAACGCCCTGGAAATTCCACTTGATGGTAAGTAGAAGAAATGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111855 Essential Splice Site 32 1253 1 28
Genomic Location:
Chromosome 6 (position 44851083)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATRTGAKCAGCAGGTATYAAACTAACGCCCTGGAAATTCCACTTGATGG[T/G]AAGTAGAAGAAATGGCTTCCTGTTTYAWGCAGTATTAATCTWGCAATWTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111855 Nonsense 795 1253 18 28
Genomic Location:
Chromosome 6 (position 44884385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGAGGCACTCATTTCTGGTCAAAAACACCCCGACGTTCGTCCTTTA[C/A]GARATCAAAATTCAGGCCAAGAACCACGCGGGCTGGGGTCCGGACCCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p7moqeta