atp10a

Ensembl ID:
ENSDARG00000076230
Human Orthologue:
ATP10B
Human Description:
ATPase, class V, type 10B [Source:HGNC Symbol;Acc:13543]
Mouse Orthologue:
Atp10b
Mouse Description:
ATPase, class V, type 10B Gene [Source:MGI Symbol;Acc:MGI:2442688]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22466 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16204 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113676 Essential Splice Site 205 1294 2 21
Genomic Location:
Chromosome 14 (position 23319309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACCAACCTCAAGCAGAGAAAGGTGGTGCCAGGCTTCTCTACTCTGG[T/C]AAGGGCAACGAGCGACAAAATATCTGTGCTAAAGATCATAAAGTTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113676 Essential Splice Site 741 1294 11 21
Genomic Location:
Chromosome 14 (position 23343151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAYGAGCCTATGYTGCKAKTGTCATTTGTTTTCYACAAATATGTCACC[A/T]GTTGAAAGTGCAGCGAAGCGAATTGCTGTGAGAACTCAAAAAGACCTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4lfplzxb