si:ch211-61f14.1

Ensembl ID:
ENSDARG00000076228
ZFIN ID:
ZDB-GENE-070912-298
Description:
kinesin-like protein KIF2C [Source:RefSeq peptide;Acc:NP_001108065]
Human Orthologue:
KIF2C
Human Description:
kinesin family member 2C [Source:HGNC Symbol;Acc:6393]
Mouse Orthologue:
Kif2c
Mouse Description:
kinesin family member 2C Gene [Source:MGI Symbol;Acc:MGI:1921054]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16566 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109849 Nonsense 275 700 10 22
ENSDART00000111430 Nonsense 264 689 9 21
ENSDART00000135884 Nonsense 264 269 9 9

The following transcripts of ENSDARG00000076228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 33657541)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33956448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCATGTTTTAGGTCAAAACTCACCGAATTTGTGTCTGCGTTCGCAAA[C/T]GACCACTGAATAAAAAAGGTAGGTTGCTGAGATGACCCCTYAAATTGAYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link