ror2

Ensembl ID:
ENSDARG00000076227
ZFIN ID:
ZDB-GENE-060427-5
Human Orthologue:
ROR2
Human Description:
receptor tyrosine kinase-like orphan receptor 2 [Source:HGNC Symbol;Acc:10257]
Mouse Orthologue:
Ror2
Mouse Description:
receptor tyrosine kinase-like orphan receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1347521]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41584 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114491 Essential Splice Site 396 939 7 9
Genomic Location:
Chromosome 10 (position 5408158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTGGACCCGAATGTTCGAGTGGATCTCTGTGACATTCCGCCCTGCAG[T/C]AAGTAGTAGAGCATTAATAATCAGACCCTCCATTTTGAGCAAATGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114491 Nonsense 830 939 9 9
Genomic Location:
Chromosome 10 (position 5409740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCTCAACTCTACATCCCAGTCAATGGCTATCAGCCAATGCCRGCTTA[C/A]CCGTATCTCCAGAACTTCTACCCCATGCAGATCCCCATGCAKATGCCACM
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link