si:dkey-11f4.16

Ensembl ID:
ENSDARG00000076224
ZFIN ID:
ZDB-GENE-070912-357
Human Orthologue:
CD48
Human Description:
CD48 molecule [Source:HGNC Symbol;Acc:1683]
Mouse Orthologue:
Cd48
Mouse Description:
CD48 antigen Gene [Source:MGI Symbol;Acc:MGI:88339]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34531 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41322 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111270 Essential Splice Site 17 475 1 12
ENSDART00000135270   None 242 None 5
ENSDART00000136529   None 224 None 2
ENSDART00000138813 Essential Splice Site 17 135 1 3
ENSDART00000142242   None 173 None 2

The following transcripts of ENSDARG00000076224 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14305)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 470205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTTTGTGGTGCGGGTTTTGCTGTTCTTTACCTGCTTCTGTTTTCAAG[G/A]TGAGCGCTTGTATTTTCTTTTTAAACATGGCTGGAGAAACTCGTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111270 Nonsense 297 475 8 12
ENSDART00000135270 Nonsense 63 242 3 5
ENSDART00000136529   None 224 None 2
ENSDART00000138813   None 135 None 3
ENSDART00000142242   None 173 None 2

The following transcripts of ENSDARG00000076224 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 21042)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 463468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTCAAACATCACTTTTGTCTCAAAATGAAAGGCCGGATGAGGAGAAC[A/T]GATCAGACAGTCCAGGTGTAAATGAGGAAGAAAAACTTCTGAATCCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link