LOC566115

Ensembl ID:
ENSDARG00000076213
Human Orthologue:
DOCK4
Human Description:
dedicator of cytokinesis 4 [Source:HGNC Symbol;Acc:19192]
Mouse Orthologue:
Dock4
Mouse Description:
dedicator of cytokinesis 4 Gene [Source:MGI Symbol;Acc:MGI:1918006]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15407 Nonsense Available for shipment Available now
sa9878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 225 1945 8 55
Genomic Location:
Chromosome 25 (position 22310281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGAGCTCCAGCCTCGGGGAGGAGCTGGAGRTCWTCTTCTCTGTCTA[C/A]GACAGCAGGGAAATGCGACCAATCAGGTGCYGTTTCTGACTCTARACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 1047 1945 31 55
Genomic Location:
Chromosome 25 (position 22239090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTTTGTGTTGTTTAAGGTATGGTGACATGAGAGTGATGATTGGTTG[T/A]GAGATTTTCAGCATGTGGCAGCATTTGGGTAAGTTGATGTGTTTAGGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sc58s21w