LOC566115

Ensembl ID:
ENSDARG00000076213
Human Orthologue:
DOCK4
Human Description:
dedicator of cytokinesis 4 [Source:HGNC Symbol;Acc:19192]
Mouse Orthologue:
Dock4
Mouse Description:
dedicator of cytokinesis 4 Gene [Source:MGI Symbol;Acc:MGI:1918006]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38073 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38072 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15407 Nonsense Available for shipment Available now
sa38071 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9878 Nonsense Available for shipment Available now
sa44301 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32532 Nonsense Mutation detected in F1 DNA During 2016
sa44300 Nonsense Mutation detected in F1 DNA During 2016
sa38070 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Essential Splice Site 6 1945 1 55
Genomic Location:
Chromosome 25 (position 22337462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAGAAGTAATTATTGAATGTATTTTTGGTATATTTTCACCCACTGGG[G/A]TAAACGTTTCCATCTCGTCCACATGCAGTTACGCAAACAAAGATCGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Essential Splice Site 54 1945 3 55
Genomic Location:
Chromosome 25 (position 22332247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGTAGGATGGTACAGAGGATTTATCACAAAGAATCCAAATGTAAAGG[T/G]AAGCCTGTGCATAATTTATATAATCCCTTTATTTCTCTCTTGATCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 225 1945 8 55
Genomic Location:
Chromosome 25 (position 22310281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGAGCTCCAGCCTCGGGGAGGAGCTGGAGRTCWTCTTCTCTGTCTA[C/A]GACAGCAGGGAAATGCGACCAATCAGGTGCYGTTTCTGACTCTARACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Essential Splice Site 760 1945 22 55
Genomic Location:
Chromosome 25 (position 22257453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTGTCCCATGAAAGTAAAGGCATCAGCCCCATCACACACACACAGG[T/C]GAGACAGATAGTGTTGTACGATACACTGGTACTACGATACCATCGCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 1047 1945 31 55
Genomic Location:
Chromosome 25 (position 22239090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTTTGTGTTGTTTAAGGTATGGTGACATGAGAGTGATGATTGGTTG[T/A]GAGATTTTCAGCATGTGGCAGCATTTGGGTAAGTTGATGTGTTTAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Essential Splice Site 1174 1945 38 55
Genomic Location:
Chromosome 25 (position 22231749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTATTTGTCTCTGTGCGTGTGGACCTCAGTGTGTGTTATATTGTTC[A/C]TCTCTTCACAGGGACTGCATGAAGATCGGGGAGGTTGATGGGAAAACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 1206 1945 39 55
Genomic Location:
Chromosome 25 (position 22231503)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGATGTTGTTCTGTTTCTTTCAGAACTTCTACAAAACTGAGCTGAAT[A/T]AAGAAGAAATGTACATCCGTTATATTCACAAGCTCTATGAGCTGCACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 1694 1945 51 55
Genomic Location:
Chromosome 25 (position 22204303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACATGTTATGTTTTTTTCAGCCCAGTCCATCTACCTCAAGTCTGAGCT[C/A]AAATCACTCCGGCTCCCACAATGTGAACAGCTCTGCTCCCTCCAGCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087817 Nonsense 1888 1945 55 55
Genomic Location:
Chromosome 25 (position 22199365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCCACAGATATGCCGATTCGCAGGGGCAGCAAGACTCCTCCACCCTA[C/A]AGTGTGTACGAGCGGAACAACCCTCGGCGGGCGACGCCACTGCCTCACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link