B0S4W0_DANRE

Ensembl ID:
ENSDARG00000076210
Description:
Novel protein similar to vertebrate zinc finger, FYVE domain containing 1 (ZFYVE1) [Source:UniProtKB
Human Orthologue:
ZFYVE1
Human Description:
zinc finger, FYVE domain containing 1 [Source:HGNC Symbol;Acc:13180]
Mouse Orthologue:
Zfyve1
Mouse Description:
zinc finger, FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3026685]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35822 Nonsense Mutation detected in F1 DNA During 2017
sa32020 Essential Splice Site Available for shipment Available now
sa28413 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8402 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111385 Nonsense 242 654 3 11
Genomic Location (Zv9):
Chromosome 15 (position 13809184)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14452527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGGCCAGAGCACAGACGCCTTCAGTTCGGTTCAGTATGTGGGCACA[C/T]AGACCATCACTCCCCCCACAGACTACTCACAGCTACAGCACACGGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111385 Essential Splice Site 385 654 6 11
Genomic Location (Zv9):
Chromosome 15 (position 13786875)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14474836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACAGACAACCCGTGGTTTGGTCTGGCCAAGTATGCGTGGTCTGGG[T/C]GAGTGAGATGCTGTATTCTGCTGTCTATGAAGCTGCTCCTCATACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111385 Essential Splice Site 424 654 7 11
Genomic Location (Zv9):
Chromosome 15 (position 13786681)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14475030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGAGAGCAGTGTGGTGCGGCCAGAGGTCAAGCACGTCTGGCAGGGGG[T/C]GAGTGTTTCTGTTCATGTGTTCAGTCTGCTGATGCTCACAGTGGTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111385 Nonsense 459 654 8 11
Genomic Location (Zv9):
Chromosome 15 (position 13786510)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14475201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGAACTACATTATTCAGTCAGTGACAGAATACAGTTCAGGGCCGACC[A/T]AAGCTGTCGCYGCGTGGCTCACAGACCAGGTGGCTCCACCTTACTGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link