ankrd1b

Ensembl ID:
ENSDARG00000076192
ZFIN ID:
ZDB-GENE-070820-13
Description:
ankyrin repeat domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001095858]
Human Orthologue:
ANKRD23
Human Description:
ankyrin repeat domain 23 [Source:HGNC Symbol;Acc:24470]
Mouse Orthologue:
Ankrd23
Mouse Description:
ankyrin repeat domain 23 Gene [Source:MGI Symbol;Acc:MGI:1925571]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19034 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9471 Essential Splice Site Available for shipment Available now
sa35242 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113810 Essential Splice Site 124 283 5 9
ENSDART00000113810 Essential Splice Site 124 283 5 9
Genomic Location (Zv9):
Chromosome 12 (position 17514003)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16393713
KASP Assay ID:
2260-5185.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTCCCCTGACAGCACTTACATCTAAAGAACTAAACGTGTTTCCTTTA[G/A]TTCAATCGTACAGCTCTACACAGAGCTTGCTCACAAGGAAACGTGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113810 Essential Splice Site 124 283 5 9
ENSDART00000113810 Essential Splice Site 124 283 5 9
Genomic Location (Zv9):
Chromosome 12 (position 17514003)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16393713
KASP Assay ID:
2260-5185.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCCCCTGACAGCACWTACATCTAAAGAACTAAAYGTGTTTCCTTTA[G/A]TTCAATCGTACAGCTCTACACAGAGCTTGCTCACAAGGAAACGTGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113810 Nonsense 267 283 9 9
Genomic Location (Zv9):
Chromosome 12 (position 17517377)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTATTCTGCAGGAGGGAAAGTCACCTATGGACAAGGTGTGTGAGTG[G/A]CAGAATGGAGCAAAATCAATCTTTGACAACTTTCAAGACAATAAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link