ankrd1b

Ensembl ID:
ENSDARG00000076192
ZFIN ID:
ZDB-GENE-070820-13
Description:
ankyrin repeat domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001095858]
Human Orthologue:
ANKRD23
Human Description:
ankyrin repeat domain 23 [Source:HGNC Symbol;Acc:24470]
Mouse Orthologue:
Ankrd23
Mouse Description:
ankyrin repeat domain 23 Gene [Source:MGI Symbol;Acc:MGI:1925571]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19034 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9471 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113810 Essential Splice Site 124 283 5 9
ENSDART00000113810 Essential Splice Site 124 283 5 9
Genomic Location:
Chromosome 12 (position 17514003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTCCCCTGACAGCACTTACATCTAAAGAACTAAACGTGTTTCCTTTA[G/A]TTCAATCGTACAGCTCTACACAGAGCTTGCTCACAAGGAAACGTGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113810 Essential Splice Site 124 283 5 9
ENSDART00000113810 Essential Splice Site 124 283 5 9
Genomic Location:
Chromosome 12 (position 17514003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCCCCTGACAGCACWTACATCTAAAGAACTAAAYGTGTTTCCTTTA[G/A]TTCAATCGTACAGCTCTACACAGAGCTTGCTCACAAGGAAACGTGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rk6bh7fu