FBXL13

Ensembl ID:
ENSDARG00000076191
Description:
F-box and leucine-rich repeat protein 13 [Source:HGNC Symbol;Acc:21658]
Human Orthologue:
FBXL13
Human Description:
F-box and leucine-rich repeat protein 13 [Source:HGNC Symbol;Acc:21658]
Mouse Orthologue:
Fbxl13
Mouse Description:
F-box and leucine-rich repeat protein 13 Gene [Source:MGI Symbol;Acc:MGI:2443416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17674 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111425 Essential Splice Site 200 767 6 21
Genomic Location:
Chromosome 25 (position 19265251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCGTCATGTTGTGCAGGACRCTAAAAGAACAAAGGAATACTTTAAG[G/A]TATAATTATTAAAACARTCARCTAAACCCAAATGCATTGAATTCAWGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0gikgo08