LOC569090

Ensembl ID:
ENSDARG00000076179
Human Orthologue:
NGEF
Human Description:
neuronal guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:7807]
Mouse Orthologue:
Ngef
Mouse Description:
neuronal guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1858414]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15674 Essential Splice Site Available for shipment Available now
sa22714 Nonsense Available for shipment Available now
sa42610 Nonsense Mutation detected in F1 DNA During 2016
sa8969 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Essential Splice Site 105 718 2 15
Genomic Location (Zv9):
Chromosome 15 (position 38726434)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40242221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCCTGCTGCAGCAAACAGAGTCCCACTGTCCCCCAGACTGCAAAAG[T/C]GAGTATTAAAAACACACCAAACACNNNNCTGTCTGTTGTTCAGTCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 364 718 7 15
Genomic Location (Zv9):
Chromosome 15 (position 38746056)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40261843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATTGTTCATTTCCACGCTGTTAACCACTTCCAAGTCTTTATCAGCTA[T/A]GTCATCAACCAGGTCTACCAGGAGACCAACTACCGGCGGATACTGTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 504 718 11 15
Genomic Location (Zv9):
Chromosome 15 (position 38759745)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40275532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCCTGAAGAAGGGTGAGGTGCAGCAGATGTCTGGACCCAAGAGCACT[C/T]GAACCATGCGCAGCCGCAAGCTTTACCATCCCATTTACCTGTTCCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 555 718 12 15
Genomic Location (Zv9):
Chromosome 15 (position 38762731)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40278518
KASP Assay ID:
2260-8914.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGATTCGTGCAGTCRCTCCATGCTGAGGACTGAGGATCTGGAGGAT[C/T]AGGGTCAGATGCTGGCCTGTGTGTTTGTGCTGAAGCTGCTGGAGAATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link