LOC569090

Ensembl ID:
ENSDARG00000076179
Human Orthologue:
NGEF
Human Description:
neuronal guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:7807]
Mouse Orthologue:
Ngef
Mouse Description:
neuronal guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1858414]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15674 Essential Splice Site Available for shipment Available now
sa4624 Nonsense Mutation detected in F1 DNA During 2014
sa22714 Nonsense Mutation detected in F1 DNA During 2014
sa8969 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Essential Splice Site 105 718 2 15
Genomic Location:
Chromosome 15 (position 38726434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCCTGCTGCAGCAAACAGAGTCCCACTGTCCCCCAGACTGCAAAAG[T/C]GAGTATTAAAAACACACCAAACACNNNNCTGTCTGTTGTTCAGTCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 211 718 5 15
Genomic Location:
Chromosome 15 (position 38736859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTGTGTGCAGATGTTTTGTATCAGGAGTACCGCGACACCTCCAAG[C/T]AGCAGGAGATCGATCAGCGGCGGCAGAGAGATGGTCTTCCCACTGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 364 718 7 15
Genomic Location:
Chromosome 15 (position 38746056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATTGTTCATTTCCACGCTGTTAACCACTTCCAAGTCTTTATCAGCTA[T/A]GTCATCAACCAGGTCTACCAGGAGACCAACTACCGGCGGATACTGTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111018 Nonsense 555 718 12 15
Genomic Location:
Chromosome 15 (position 38762731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGATTCGTGCAGTCRCTCCATGCTGAGGACTGAGGATCTGGAGGAT[C/T]AGGGTCAGATGCTGGCCTGTGTGTTTGTGCTGAAGCTGCTGGAGAATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kxvch2ob