polr2a

Ensembl ID:
ENSDARG00000076177
ZFIN ID:
ZDB-GENE-041008-78
Description:
Polr2a protein [Source:UniProtKB/TrEMBL;Acc:Q58EF0]
Human Orthologue:
POLR2A
Human Description:
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa [Source:HGNC Symbol;Acc:9187]
Mouse Orthologue:
Polr2a
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98086]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35290 Nonsense Mutation detected in F1 DNA During 2017
sa22095 Nonsense Available for shipment Available now
sa18581 Nonsense Available for shipment Available now
sa38889 Nonsense Mutation detected in F1 DNA During 2017
sa35291 Nonsense Mutation detected in F1 DNA During 2017
sa42025 Nonsense Mutation detected in F1 DNA During 2017
sa42026 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 289 1965 6 28
Genomic Location (Zv9):
Chromosome 12 (position 23918277)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22441595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAACACACAAGTTGGCTGACATTGTCAAGATCAATAACCAGCTGAAG[C/T]GAAATGAGCAGAGTGGAGCAGCAGCTCATGTTATAGCAGAGGATGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 708 1965 13 28
Genomic Location (Zv9):
Chromosome 12 (position 23921025)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22444350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATAAGGCGACATATCAGGACATTCAGAACACTATCAAGAAAGCCAAA[C/T]AGGATGTGATAGAGGTGCGGTGGCATTGTTACTAAATATCAAGGCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 925 1965 17 28
Genomic Location (Zv9):
Chromosome 12 (position 23922284)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22445605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACCTCTTTTTCCAATCACACAGGTTCAAGTTTGACTACGCCAATGAA[C/T]GAGCTCTCCGCCGCACTCTTCAGGAAGATGTGGTGAAAGATGTGATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 1013 1965 19 28
Genomic Location (Zv9):
Chromosome 12 (position 23923002)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22446311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTTCATTAAATTTTCCTCTGCTTTTATTTTTGTAGGAGTTAAGGAGT[T/A]GAGTAAGAAGCTGGTGATTGTAAATGGCGATGACCAGTTAAGCAGGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 1174 1965 20 28
Genomic Location (Zv9):
Chromosome 12 (position 23923624)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22446933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGCACACAACCCTGCGCAAGGTCACTGCCAACACAGCCATTTATTA[T/G]GACCCCAACCCTCAGAACACTGTGGTGACTGAGGATCAAGAGTGGGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 1331 1965 23 28
Genomic Location (Zv9):
Chromosome 12 (position 23924454)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22447763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAATCATCATCACAGAAGATGGAGAGTTTAAAGCCCTGCAGGAGTG[G/A]ATCCTGGAAACAGATGGAGTCAGTCTCATGAGGGTCCTTAGTGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077495 Nonsense 1937 1965 28 28
Genomic Location (Zv9):
Chromosome 12 (position 23926720)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22450024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCCACTTCCCCCACTTACTCTCCCACTAGTCCCAAGGGCTCCACTTA[C/A]AGCCCCACTTCTCCTGGCTACAGCCCCACCTCTCCAACCTACAGCCCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link