ptcd1

Ensembl ID:
ENSDARG00000076176
ZFIN ID:
ZDB-GENE-030131-6146
Human Orthologues:
PTCD1, RP5-900K19.1
Human Descriptions:
pentatricopeptide repeat domain 1 [Source:HGNC Symbol;Acc:22198]
Pentatricopeptide repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:O75127]
Mouse Orthologue:
Ptcd1
Mouse Description:
pentatricopeptide repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1919049]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32591 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32590 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114613 Essential Splice Site 306 697 4 8
Genomic Location (Zv9):
Chromosome 1 (position 7638061)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7877866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGCTGTGTGAATGACAAGCAGCATGGGTTCAGACTGGCTTTACAGG[T/A]ACATACACACACCTACTGACTAGAAACAACAGCTAATTGTGGGCATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114613 Nonsense 694 697 8 8
Genomic Location (Zv9):
Chromosome 1 (position 7631563)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7871368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCAAGTATCAGTCACCGAAACCAGAGTCAAATCAAGATGGAGTAAAA[C/T]AAGTTTCAGAATAAATCTTGACTCAATTGAGCTTGAAGTTATACATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link