si:ch211-215c3.2

Ensembl ID:
ENSDARG00000076171
ZFIN ID:
ZDB-GENE-090312-211
Description:
Novel protein similar to H.sapiens ZNF827, zinc finger protein 827 (ZNF827) [Source:UniProtKB/TrEMBL
Human Orthologue:
ZNF827
Human Description:
zinc finger protein 827 [Source:HGNC Symbol;Acc:27193]
Mouse Orthologue:
Zfp827
Mouse Description:
zinc finger protein 827 Gene [Source:MGI Symbol;Acc:MGI:2444807]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18170 Nonsense Available for shipment Available now
sa19530 Nonsense Available for shipment Available now
sa4854 Nonsense F2 line generated During 2017
sa9707 Nonsense Available for shipment Available now
sa12453 Essential Splice Site Available for shipment Available now
sa14020 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Nonsense 267 1150 2 14
ENSDART00000139883   None 138 None 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35826973)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35386831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGCCAACGCCGTGCTCCAAGACAAGAACGCGGTGGCCTCCTCCACCT[C/A]GGCATCTTCATCCTCCTCGTCCTCCTCCTCATCCTCTTCAGTCACCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Nonsense 703 1150 5 14
ENSDART00000139883   None 138 None 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35786565)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35346423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAAGAGAGGAGGGGAGCCCGATGTTGGGCAAGAGCAGCCTTCTCAGC[C/T]AGGACATCAACGTCAAAGTGGCCTCTGAATTGCTTATGAAGCTCTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4854
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Nonsense 773 1150 6 14
ENSDART00000139883   None 138 None 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35765317)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35325175
KASP Assay ID:
554-3542.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGACCATGTGAAAAGAAGGAACCAATGGTCAACCTCCMAGATCATT[T/A]GCCCCGCCCCCAGAATGACCTCTTCTCGCAGGACATATCGGTCAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Nonsense 908 1150 10 14
ENSDART00000139883 Nonsense 37 138 2 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35745049)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35304907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTGTCTCTACAGAAGAGAGGAAATACAAGTGTCATTTGTGTCCATA[T/A]GCAGCTAAGTGCCGAGCMAACCTCAACCAGCACCTCACCATCCACTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Essential Splice Site 1076 1150 11 14
ENSDART00000139883   None 138 None 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35740349)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35300207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGCCAATCAAGCTTAGGCCCAGGAGCAGAGGAAAAAGCAGAGAAAGG[T/C]GAGACTTTTAGCAGATACACCTAGCGCATTTTATCCCTGATTAAGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037516 Nonsense 1092 1150 12 14
ENSDART00000139883   None 138 None 2
ENSDART00000141562   None 196 None 2
Genomic Location (Zv9):
Chromosome 1 (position 35737849)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35297707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTGAATGCGTCTTCTGCAACTTTGTGTGTAAAACCCGACCCATGTA[C/A]GAGCGGCACCTAMAGATCCACCTGATCAYGYGCATGTTTGAGTGTGACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link