pcsk1nl

Ensembl ID:
ENSDARG00000076170
ZFIN ID:
ZDB-GENE-090427-2
Description:
proprotein convertase subtilisin/kexin type 1 inhibitor, like [Source:RefSeq peptide;Acc:NP_0011596

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41118 Nonsense Mutation detected in F1 DNA During 2017
sa12969 Nonsense Available for shipment Available now
sa27131 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121708 Nonsense 134 333 2 3
Genomic Location (Zv9):
Chromosome 8 (position 7908095)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7352732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCGGACAGGGCAGAGCAGGGGACCAGGAGGAAGAAGGGGGGGATTTT[C/T]AGGGTCCATATCCTCCTGATTATGATGAGACTGAGCAGGCTGTGAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121708 Nonsense 174 333 2 3
Genomic Location (Zv9):
Chromosome 8 (position 7908215)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7352852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGGTCTTCTAGATCCTCAGCTCACTCAGGCTCTGCTCAACCGCTAC[A/T]AGCAGGAGAGACTTGTGCAGGCCGGACTCGCACCCGCAGCTAACAGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121708 Essential Splice Site 203 333 2 3
Genomic Location (Zv9):
Chromosome 8 (position 7908305)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7352942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACAGGATTCCAGAGAGAGAGCAGGACAAAGACCAGGAGATGCTCAGG[T/G]AACACATACAAACTAGCGTATACAGTTGAAGTCAGAATTATTAGCCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121708 Nonsense 239 333 3 3
Genomic Location (Zv9):
Chromosome 8 (position 7913057)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7357694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAAACCCGAGAGCCAAACGAGACCTGAGTGCAGTGTCCAGCATAGAG[A/T]GACCCATAAAACCCGCCCTCAAACGCTCCCGTCGCTCTCTAGACTCCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link