col19a1

Ensembl ID:
ENSDARG00000076163
ZFIN ID:
ZDB-GENE-090312-196
Description:
Novel protein similar to vertebrate collagen family [Source:UniProtKB/TrEMBL;Acc:B8A4T5]
Human Orthologue:
COL19A1
Human Description:
collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
Mouse Orthologue:
Col19a1
Mouse Description:
collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5789 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22363 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436 Essential Splice Site 60 488 7 34
ENSDART00000145979 None None 617 None 30
Genomic Location:
Chromosome 13 (position 39596326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTAGCTTYCTTTCAATRACATTTGTTAAACGTTTATWGCTACCTAGT[T/G]AGGATACTTTYAGTRTATTATACTGCTATGCTAATTAAAATGTGTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436 Nonsense 395 488 30 34
ENSDART00000145979 None None 617 None 30
Genomic Location:
Chromosome 13 (position 39633719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTGATGATGTCCCATTTTGGCTCTTTGTCTTTGCACACAGGGAGAA[C/T]GAGGGCCTGTGGGAGAGACTGGCTTCCCTGGACCTGAAGGGCCTCCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ejpwbbe8