col19a1

Ensembl ID:
ENSDARG00000076163
ZFIN ID:
ZDB-GENE-090312-196
Description:
Novel protein similar to vertebrate collagen family [Source:UniProtKB/TrEMBL;Acc:B8A4T5]
Human Orthologue:
COL19A1
Human Description:
collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
Mouse Orthologue:
Col19a1
Mouse Description:
collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42271 Nonsense Mutation detected in F1 DNA During 2016
sa42272 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42273 Nonsense Mutation detected in F1 DNA During 2016
sa22363 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436 Nonsense 96 488 10 34
ENSDART00000145979 Nonsense 127 617 8 30
Genomic Location (Zv9):
Chromosome 13 (position 39598869)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38912970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGGCGATGCAGGCGGAGCGCCGGGGCCAGCAGGACCCCCTGGCCTC[A/T]AGGGTGAGCCTGGTGAGCCCTGCTCTGTCGGACTTTGCGGTGGGGTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436 Essential Splice Site 110 488 10 34
ENSDART00000145979 Essential Splice Site 141 617 8 30
Genomic Location (Zv9):
Chromosome 13 (position 39598915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38913016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGGGTGAGCCTGGTGAGCCCTGCTCTGTCGGACTTTGCGGTGGGG[T/C]AGGTACAAAACACCATTCATGCCTTTCTCTTTAACTTCAACTTTAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436   None 488 None 34
ENSDART00000145979 Nonsense 351 617 20 30
Genomic Location (Zv9):
Chromosome 13 (position 39619385)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38933486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTAAAAACCTTGTTTGTTTTGTTTTGTTTGTTTAAGGGTGCTCCATA[T/A]TCAGAGGGCAACGGGATGAGCAGTATCTATAAGCTTCAGGTAAAGCCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076436 Nonsense 395 488 30 34
ENSDART00000145979   None 617 None 30
Genomic Location (Zv9):
Chromosome 13 (position 39633719)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38947820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTGATGATGTCCCATTTTGGCTCTTTGTCTTTGCACACAGGGAGAA[C/T]GAGGGCCTGTGGGAGAGACTGGCTTCCCTGGACCTGAAGGGCCTCCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link