ITCH (1 of 2)

Ensembl ID:
ENSDARG00000076149
Description:
itchy E3 ubiquitin protein ligase homolog (mouse) [Source:HGNC Symbol;Acc:13890]
Human Orthologue:
ITCH
Human Description:
itchy E3 ubiquitin protein ligase homolog (mouse) [Source:HGNC Symbol;Acc:13890]
Mouse Orthologue:
Itch
Mouse Description:
itchy, E3 ubiquitin protein ligase Gene [Source:MGI Symbol;Acc:MGI:1202301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32568 Nonsense Available for shipment Available now
sa30531 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087334 Nonsense 121 842 4 22
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 102756)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43673585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTCCCGACTCTTGTGTGTTTCAGTCTGTGAGGTGGTGCAGACGCTA[C/T]AACTGTGCGACAGGGATCAGTCTGACAGCATCGGGGATCTGTCCGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087334 Nonsense 365 842 9 22
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 93264)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43664093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGAACTACCACATGGCAGCGGCCCACCATGGAGACGGTGCGCAACTA[T/A]GAGCAGTGGCAGCACCAGCGCAGTCAGCTGCAGGGGGCAATGCAGCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link