LOC556748

Ensembl ID:
ENSDARG00000076143
Human Orthologue:
PPIP5K1
Human Description:
diphosphoinositol pentakisphosphate kinase 1 [Source:HGNC Symbol;Acc:29023]
Mouse Orthologue:
Ppip5k1
Mouse Description:
diphosphoinositol pentakisphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2443281]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21076 Nonsense Available for shipment Available now
sa18894 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10406 Essential Splice Site Available for shipment Available now
sa18089 Essential Splice Site Available for shipment Available now
sa21077 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21078 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16976 Nonsense Available for shipment Available now
sa2349 Nonsense Available for shipment Available now
sa8681 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Nonsense 347 1345 8 29
Genomic Location:
Chromosome 7 (position 54236034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGATGTCAATGGATTTAGCTTTGTGAAGAATTCCATGAAATACTA[T/A]GACGACTGTGCTAAGATACTGGGGTAAAAGCTAATAATAAAGACCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Essential Splice Site 355 1345 8 29
ENSDART00000111444 Essential Splice Site 355 1345 8 29
Genomic Location:
Chromosome 7 (position 54236058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGAAGAATTCCATGAAATACTATGACGACTGTGCTAAGATACTGGG[G/A]TAAAAGCTAATAATAAAGACCCAAAAGTTTGAAAAGTTTGTCTTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Essential Splice Site 355 1345 8 29
ENSDART00000111444 Essential Splice Site 355 1345 8 29
Genomic Location:
Chromosome 7 (position 54236058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGAAGAATTCCATGAAATACTATGACGACTGTGCTAAGAYACTGGG[G/A]TAAAAGCTAATAATAAAGACCCAAAAGTTTGAAAAGTTTGTCTTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Essential Splice Site 508 1345 13 29
Genomic Location:
Chromosome 7 (position 54240469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAACATACCTTCCTCATGGACAACCCAAAACATCCAGTGAGGARGAAG[G/T]TATGAGGATTGTTGATAGGAAAATTTGTTGGGTTRAAATCGTGTTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Essential Splice Site 550 1345 14 29
Genomic Location:
Chromosome 7 (position 54240669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGAAGAACTCGGCAGGGCTTTTCGCTGCATGTATCCTGGAGGTCAAG[G/A]TACAGTATGGTCAATTACACAGACATTTATTACACTTGTGCCTTTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Essential Splice Site 652 1345 16 29
Genomic Location:
Chromosome 7 (position 54243026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGATCATGCAGAAAGATAAAGTCTTCACTGAAGAAGACTATGACAGG[G/A]TACATTTGGAGTGTCTTTTGAACTGTATTTCAGCCCTCCGCTGACTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Nonsense 1191 1345 29 29
Genomic Location:
Chromosome 7 (position 54275086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACACCTCTCCACGCTTCAGCTTCAGTGAGAAGATCACCCTAACGCCT[C/T]AGAGCAGTGAAGAGATCCACCAGATYCCTCAAAACAACAACTGMCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Nonsense 1205 1345 29 29
Genomic Location:
Chromosome 7 (position 54275130)
KASP Assay ID:
554-2614.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCCTCAGAGCAGTGAAGAGATCCACCAGATCCCTCAAAACAACAACTG[C/A]CACACTGTGWCTTTGACATCCGAACCCAGCATACCCTCAGASGACCCGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111444 Nonsense 1332 1345 29 29
Genomic Location:
Chromosome 7 (position 54275509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAACGGTTGACGCTTGGAGGGAGAACCCGGCATCCCTGCCCCATCCT[G/T]GAACTCCTCTGGAGGTGGGARCTCCACACGTGCCTGAGCCTTGAAGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hl0d52fc