trib1

Ensembl ID:
ENSDARG00000076142
ZFIN ID:
ZDB-GENE-091207-4
Human Orthologue:
TRIB1
Human Description:
tribbles homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:16891]
Mouse Orthologue:
Trib1
Mouse Description:
tribbles homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443397]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15120 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109868 Nonsense 158 195 2 2
Genomic Location:
Chromosome 19 (position 34575036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGACATGCACACWTTTGTAAAGAGCAGCAAGAGGCTTTCTGAAGACT[T/A]GGCATCCAAGCTTTTCTACCAGGTTGTATCTGCAGTGAATCATTGCCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nnbqb2qs