LOC100331221

Ensembl ID:
ENSDARG00000076141
Human Orthologue:
ANO1
Human Description:
anoctamin 1, calcium activated chloride channel [Source:HGNC Symbol;Acc:21625]
Mouse Orthologue:
Ano1
Mouse Description:
anoctamin 1, calcium activated chloride channel Gene [Source:MGI Symbol;Acc:MGI:2142149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa961 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa961
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109158 Nonsense 294 351 8 9
Genomic Location:
Chromosome 25 (position 36409393)
KASP Assay ID:
554-0866.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGGCTTCGTCAACCACACGCTCTCCTACTTCAACGTCAGTCACTTC[C/T]AGAATGGCACRGCACCACTGGAGCCCTTTCACCTGGGCTTCCACGTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fy2xoswi