si:ch211-134m17.7

Ensembl ID:
ENSDARG00000076135
ZFIN IDs:
ZDB-GENE-080424-3, ZDB-GENE-080424-3, ZDB-GENE-090313-29
Description:
Novel protein similar to vertebrate multimerin family [Source:UniProtKB/TrEMBL;Acc:B8A4A4]
Human Orthologues:
MMRN1, MMRN2
Human Descriptions:
multimerin 1 [Source:HGNC Symbol;Acc:7178]
multimerin 2 [Source:HGNC Symbol;Acc:19888]
Mouse Orthologues:
Mmrn1, Mmrn2
Mouse Descriptions:
multimerin 1 Gene [Source:MGI Symbol;Acc:MGI:1918195]
multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa548 Nonsense F2 line generated During 2017
sa22282 Nonsense Available for shipment Available now
sa22281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa548
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 148 1093 2 8
ENSDART00000136808 Nonsense 142 544 2 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22773042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22502380
KASP Assay ID:
554-0458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATACATACCAGGTTGCRTTGTTGATGTTGTCTCTCCTTTCCAGGAATTG[G/A]TGTGCGTTTGTTCACAAGCAGGCTGTGACTGTGGCTGTAGCCTGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 287 1093 5 8
ENSDART00000136808 Nonsense 281 544 5 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22768157)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22497495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGGTCTAATGTATGAAGCTCAGCAACCTGATGTGGAGAATCAAACT[G/T]GACCGTCCATAGAGGATTATGAGCATATCCCTCCTGCTGGTCAAGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 609 1093 7 8
ENSDART00000136808   None 544 None 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22762208)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22491546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCAGGATGTGGAGACTGATGTCGACAACATTTATATCGATTTTTAC[A/T]AAAATATAAGTTCAGCAAGTGGAGAATGTGACTGCATTGCTCTTGGAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link