ENSDARG00000076131

Ensembl ID:
ENSDARG00000076131
Human Orthologue:
AC092718.1
Mouse Orthologue:
Pkd1l2
Mouse Description:
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39441 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099402 Essential Splice Site 78 225 3 5
Genomic Location (Zv9):
Chromosome 24 (position 17870006)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17176482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAACACAATAAAGTGGAAATACTGTTTACTATGTGTGTTGCTTTAACA[G/A]ACAGGAGCTGCTTTCTCTCTTATTGGAAGTCCAGTCATTACAAAGATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link