prkar1aa

Ensembl ID:
ENSDARG00000076128
ZFIN ID:
ZDB-GENE-050116-2
Description:
protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) a [Sourc
Human Orthologue:
PRKAR1A
Human Description:
protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) [Source:H
Mouse Orthologue:
Prkar1a
Mouse Description:
protein kinase, cAMP dependent regulatory, type I, alpha Gene [Source:MGI Symbol;Acc:MGI:104878]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10163 Essential Splice Site Available for shipment Available now
sa20078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102380 Essential Splice Site 145 379 4 12
ENSDART00000141638 Essential Splice Site 145 379 4 11
Genomic Location (Zv9):
Chromosome 3 (position 36266966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36138250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATTGAAAAGAATGTTYTTTTTGCTCATCTTGACKACAAYGAAAGAAG[G/A]TAAARCATTTTTTGGTTTTGATTGTTTGGTTTGATTATAGAGWACAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102380 Nonsense 297 379 10 12
ENSDART00000141638 Nonsense 297 379 10 11
Genomic Location (Zv9):
Chromosome 3 (position 36265020)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36136304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATCAAAGGAGAAGAGAGGTATTGAATTAGACTTGTGTCCTCAGGGCT[C/A]GGCTGCGGTCTTGCAACGGCGGTCGGAGAATGAAGAATTTGTGGAGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link