si:ch211-160b11.4

Ensembl ID:
ENSDARG00000076122
ZFIN ID:
ZDB-GENE-081104-142
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V232]
Human Orthologues:
REG1A, REG1B, REG3A, REG3G, REG4
Human Descriptions:
regenerating islet-derived 1 alpha [Source:HGNC Symbol;Acc:9951]
regenerating islet-derived 1 beta [Source:HGNC Symbol;Acc:9952]
regenerating islet-derived 3 alpha [Source:HGNC Symbol;Acc:8601]
regenerating islet-derived 3 gamma [Source:HGNC Symbol;Acc:29595]
regenerating islet-derived family, member 4 [Source:HGNC Symbol;Acc:22977]
Mouse Orthologues:
Reg1, Reg2, Reg3a, Reg3b, Reg3d, Reg3g, Reg4
Mouse Descriptions:
regenerating islet-derived 1 Gene [Source:MGI Symbol;Acc:MGI:97895]
regenerating islet-derived 2 Gene [Source:MGI Symbol;Acc:MGI:97896]
regenerating islet-derived 3 alpha Gene [Source:MGI Symbol;Acc:MGI:109408]
regenerating islet-derived 3 beta Gene [Source:MGI Symbol;Acc:MGI:97478]
regenerating islet-derived 3 delta Gene [Source:MGI Symbol;Acc:MGI:1353426]
regenerating islet-derived 3 gamma Gene [Source:MGI Symbol;Acc:MGI:109406]
regenerating islet-derived family, member 4 Gene [Source:MGI Symbol;Acc:MGI:1914959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7633 Missense Mutation detected in F1 DNA During 2017
sa12699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110325 Missense 135 289 1 5
ENSDART00000137862 Missense 169 323 3 7
Genomic Location (Zv9):
Chromosome 9 (position 35956036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35175547
KASP Assay ID:
554-4360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGGAGGAACCTGNNNNNNNNNNNNTGGAATTCCAGTCTGAGGAGCCCACACTTCAAGCWGA[C/A]TATATAGTGGTTGAAGAAYCAGAAGTAGACATGAWTCCTGGCAGRAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110325 Nonsense 211 289 3 5
ENSDART00000137862 Nonsense 245 323 5 7
Genomic Location (Zv9):
Chromosome 9 (position 35953644)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35173155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGRTCACYTGGCTTCYGTGACAAGCAGCTTTATTCGTGCTGAAATCTA[T/A]AATCTAATGGACCRGTACAGCAGCCGCTCTGACACATGGCTTGGAGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link