A8WGB5_DANRE

Ensembl ID:
ENSDARG00000076121
Description:
LOC556700 protein [Source:UniProtKB/TrEMBL;Acc:A8WGB5]
Human Orthologue:
SMPD1
Human Description:
sphingomyelin phosphodiesterase 1, acid lysosomal [Source:HGNC Symbol;Acc:11120]
Mouse Orthologue:
Smpd1
Mouse Description:
sphingomyelin phosphodiesterase 1, acid lysosomal Gene [Source:MGI Symbol;Acc:MGI:98325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3771 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114277 Nonsense 526 591 6 6
Genomic Location:
Chromosome 10 (position 25142268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGAGCATCCGAAGCCTACGGTCTGTCCACACTCTTCCCTTCAGACATG[G/T]AGGCTCTGATCAAACACATGGTGAATGACGATCGCATTTTCCAGCAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lp8efor8