B3DJK9_DANRE

Ensembl ID:
ENSDARG00000076120
Description:
Rassf8 protein [Source:UniProtKB/TrEMBL;Acc:B3DJK9]
Human Orthologue:
FOXP4
Human Description:
forkhead box P4 [Source:HGNC Symbol;Acc:20842]
Mouse Orthologue:
Foxp4
Mouse Description:
forkhead box P4 Gene [Source:MGI Symbol;Acc:MGI:1921373]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31825 Nonsense Available for shipment Available now
sa35072 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114288 Nonsense 187 696 6 18
ENSDART00000122918 Nonsense 187 696 5 18
Genomic Location (Zv9):
Chromosome 11 (position 22862877)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21869108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGATCCAGATGCAACAGCTACAGCAGCAACACATTCTGAATCTACAA[A/T]GACAAGGCCTGGTGAACCTACAGCCGGGCCAAGGAGCAGTACCCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114288 Essential Splice Site 207 696 6 18
ENSDART00000122918 Essential Splice Site 207 696 5 18
Genomic Location (Zv9):
Chromosome 11 (position 22862941)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21869172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTACAGCCGGGCCAAGGAGCAGTACCCATTCAGAGCCTGCAGCAAG[G/A]TACACAATAAAATCAAACACAGCATTTGTTGAACCAGACTAACAAGTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link