emid1

Ensembl ID:
ENSDARG00000076119
ZFIN ID:
ZDB-GENE-070705-40
Description:
Novel protein containing an EMI domain [Source:UniProtKB/TrEMBL;Acc:A5PMT1]
Human Orthologue:
EMID1
Human Description:
EMI domain containing 1 [Source:HGNC Symbol;Acc:18036]
Mouse Orthologue:
Emid1
Mouse Description:
EMI domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2155091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17183 Essential Splice Site Available for shipment Available now
sa2245 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114424 Essential Splice Site 67 211 None 9
ENSDART00000146872 Essential Splice Site 306 447 None 16
Genomic Location:
Chromosome 5 (position 26570793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNGCCCCCTCGCAYGGACCACCAGGYCCAGCTGGAYCAACCGG[T/G]CAGTAAATCAGAATTAAGAGAACATTTTGATTTCATTATTGGTCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2245
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114424 Nonsense 110 211 5 9
ENSDART00000146872 Nonsense 349 447 13 16
Genomic Location:
Chromosome 5 (position 26565651)
KASP Assay ID:
554-3233.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGTGCATTTCTCACCTTTAATGTAATTAACAGGGACCTCTTGGATA[T/A]CCAGGAGAGAGAGGGTTCAAAGGAGAGCCGGTAAGATGCCTGCTTTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3aaw8gj4