si:ch211-268f14.2

Ensembl ID:
ENSDARG00000076113
ZFIN ID:
ZDB-GENE-070705-261
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW76]
Human Orthologue:
TRAPPC9
Human Description:
trafficking protein particle complex 9 [Source:HGNC Symbol;Acc:30832]
Mouse Orthologue:
Trappc9
Mouse Description:
trafficking protein particle complex 9 Gene [Source:MGI Symbol;Acc:MGI:1923760]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7465 Missense Mutation detected in F1 DNA During 2017
sa4781 Nonsense F2 line generated During 2017
sa43208 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Missense 12 164 1 3
ENSDART00000141079   None 133 None 2
Genomic Location (Zv9):
Chromosome 19 (position 5166858)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4418204
KASP Assay ID:
554-4084.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTTGACCAGCGGTGCACTCGTCTCTTCAGCGCGGCGGGGAGGCCAGT[G/A]TGGAGGGCGTCCTYAACCAGCTGATCCTRGAGCATCTGCAGCTGGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4781
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Nonsense 81 164 2 3
ENSDART00000141079 Nonsense 50 133 1 2
Genomic Location (Zv9):
Chromosome 19 (position 5275681)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4526937
KASP Assay ID:
554-3531.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCGCCGTCGGGCCCTTYKCTCTGACCGTCGTCCCCTTCCAGGACTA[T/A]CAGAACGGGGTGCAAAACTAYGAGCTGCAGGACGCCGTCACCTTCATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Essential Splice Site 106 164 2 3
ENSDART00000141079 Essential Splice Site 75 133 1 2
Genomic Location (Zv9):
Chromosome 19 (position 5275757)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4527013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGACGCCGTCACCTTCATCGGCTCCAACACCTTCTACATCAACTCG[G/A]TAAGCGAAGCGGAGGGACACTGACCCACATCATCATCGAGATTTCCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link