NWD1

Ensembl ID:
ENSDARG00000076110
Description:
NACHT and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:27619]
Human Orthologue:
NWD1
Human Description:
NACHT and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:27619]
Mouse Orthologue:
Nwd1
Mouse Description:
NACHT and WD repeat domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442268]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13940 Nonsense Available for shipment Available now
sa13770 Nonsense Available for shipment Available now
sa739 Essential Splice Site Available for shipment Available now
sa35019 Essential Splice Site Available for shipment Available now
sa4405 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa13940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111559 Nonsense 236 1312 1 15
Genomic Location (Zv9):
Chromosome 11 (position 7311965)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7213387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACAAGGAGACACTCTTCTACTCATTCTAGACTCATTGGAGCAGYTTT[T/A]AGARACAAACAAACTTCATAAACTAGACTGGATACCTAAAATAATTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111559 Nonsense 383 1312 2 15
Genomic Location (Zv9):
Chromosome 11 (position 7310998)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7214354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGAATCTTTAAATGTAATCGTTTACTTTTCACATTTGAAACAGATA[T/A]GGACTTTCAGAGGCAGAGTTACAGGATGKCCTAKCATTAGATAATGATGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111559 Essential Splice Site 807 1312 10 15
Genomic Location (Zv9):
Chromosome 11 (position 7298667)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7226685
KASP Assay ID:
554-0646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATATCCACCGGCACTCAGACTTCCCAGACCCTCCTGCCCTACTCTGC[C/T]GGACACCAYAACATCACCTGCTGTCTCACACTCACCAAACACTCCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111559 Essential Splice Site 944 1312 11 15
Genomic Location (Zv9):
Chromosome 11 (position 7296413)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7228939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCGAAGGTAGCGAAATCATCACGAGTGCCCAGGATCGTATAATACGG[G/T]TCAGTTTAATCCCCTTCTTCCCAGAAAGGTACAGTGTCCTCTCATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4405
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111559 Nonsense 1031 1312 12 15
Genomic Location (Zv9):
Chromosome 11 (position 7296069)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7229283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATACTGTATTCTATGTCAAGGAGGGAAATAAAACCGAGGTTTTCACCTG[G/A]AGCTGTTCGGAAGGTGAAACATGTAATAAAAGGATATTATTTTCCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link