B6E445_DANRE

Ensembl ID:
ENSDARG00000076104
Description:
Semaphorin 4b [Source:UniProtKB/TrEMBL;Acc:B6E445]
Human Orthologue:
SEMA4B
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4b
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11494 Nonsense Available for shipment Available now
sa13494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 444 849 10 14
Genomic Location:
Chromosome 7 (position 31595922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTYCTGTCAGAAGTCAGCCTGTGCTYTTCACACACACTGTGCACTACACA[C/T]AAATCGCTGTGCACCACGTGAAGGGTCTCCACAGAGCTTATGACGTRATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 655 849 14 14
Genomic Location:
Chromosome 7 (position 31599952)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTGGTAGTCAGCGGCCGAGCAGGCAGYGACGAGGTCTTCTCATGTTG[G/A]KCARAAGAACGTGGCTTTTGGCAACTCTTGGCCAATTACTGCGTGAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2ynppq29