B6E445_DANRE

Ensembl ID:
ENSDARG00000076104
Description:
Semaphorin 4b [Source:UniProtKB/TrEMBL;Acc:B6E445]
Human Orthologue:
SEMA4B
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4b
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11494 Nonsense Available for shipment Available now
sa13494 Nonsense Available for shipment Available now
sa44667 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 444 849 10 14
Genomic Location (Zv9):
Chromosome 7 (position 31595922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29988264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTYCTGTCAGAAGTCAGCCTGTGCTYTTCACACACACTGTGCACTACACA[C/T]AAATCGCTGTGCACCACGTGAAGGGTCTCCACAGAGCTTATGACGTRATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 655 849 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31599952)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29992294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTGGTAGTCAGCGGCCGAGCAGGCAGYGACGAGGTCTTCTCATGTTG[G/A]KCARAAGAACGTGGCTTTTGGCAACTCTTGGCCAATTACTGCGTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 839 849 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31600502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGAGAGTCATGTGGAGGTCAGTGACATTAGCCCTCGTCCTCGGGTA[C/T]GACTAGGCTCTGAGATTAGAGACTCTGTGGTGTAAAATACTGCATATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link