LOC559694

Ensembl ID:
ENSDARG00000076094
Human Orthologue:
KLHL30
Human Description:
kelch-like 30 (Drosophila) [Source:HGNC Symbol;Acc:24770]
Mouse Orthologue:
Klhl30
Mouse Description:
kelch-like 30 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918038]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20706 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15354 Essential Splice Site Available for shipment Available now
sa10247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114048 Essential Splice Site 258 593 1 7
Genomic Location:
Chromosome 6 (position 27049085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAACTCACTAGAATCCAGAGAGCTGGTCGAGAGGATATGTAGAGAG[G/A]TTGAAACTTATCTGTTTATATACTGTAGACAATTTTTCAAACTAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114048 Essential Splice Site 258 593 1 7
Genomic Location:
Chromosome 6 (position 27049086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAACTCACTAGAATCCAGAGAGCTGGTCGAGAGGATATGTAGAGAGG[T/C]TGRAACTTATCTGTTTATATACTGTAGAYAAWTTTTCAAACTAGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114048 Nonsense 270 593 2 7
Genomic Location:
Chromosome 6 (position 27049210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCTCTTCTTCAGAAGCGACAATTGACGGGAGATGGAAAGACTGAG[C/T]AGAGAGCCACKCAGGATGCTTTCAACCAACAAGAGGTTTTATTTGTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cbb2ijd4