LOC555987

Ensembl ID:
ENSDARG00000076090
Human Orthologue:
JAKMIP1
Human Description:
janus kinase and microtubule interacting protein 1 [Source:HGNC Symbol;Acc:26460]
Mouse Orthologue:
Jakmip1
Mouse Description:
janus kinase and microtubule interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1923321]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42365 Nonsense Mutation detected in F1 DNA During 2016
sa35659 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28282 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28281 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22443 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111315 Nonsense 167 824 2 20
Genomic Location:
Chromosome 14 (position 15114181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGAGAAACTCAGACTGACGCAGGAGCTTCAGGAGGCCAAGACGTCA[C/T]GAAGGCAGGCAGAAGAGGCACTGGCCCATGCTGTACAGGCGGACCGGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111315 Essential Splice Site 543 824 10 20
Genomic Location:
Chromosome 14 (position 15083747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGGCACGGATTGCCGACCTGGAGCGGAGCTTGGCAGAGAAGGGGCAG[G/A]TAAATGAGAAAGAGGGCGGGGAGAAGAAACCCCTGACTCCAGTCACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111315 Essential Splice Site 564 824 11 20
Genomic Location:
Chromosome 14 (position 15077587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAAAAACAAAATCTCATCAGGATAAACCAGGAGCTCAGAGAAAAG[G/A]TACAGCCTTTATCTTTAAATATCCTAAAACAGGCCTCAACATATACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111315 Essential Splice Site 647 824 14 20
Genomic Location:
Chromosome 14 (position 15071747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATTCCTGACCTCATGAAAAAGCTTGACATTCTTGGGGATAATGGGG[T/A]AAGAATTGTACATTTCGGCTGTTGTCTACTCGTTTGTCTTGTATCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111315 Essential Splice Site 669 824 15 20
Genomic Location:
Chromosome 14 (position 15071596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGTGACGGTGATTCAGGCGGGCACTGTGCTGTCTTTATGTGAAAAG[G/A]TATCTTCTCCTTCATTCTCTAAAGATAAGATTTGTCTATTATGTTGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link