LOC557135

Ensembl ID:
ENSDARG00000076079
Human Orthologue:
USH1G
Human Description:
Usher syndrome 1G (autosomal recessive) [Source:HGNC Symbol;Acc:16356]
Mouse Orthologue:
Ush1g
Mouse Description:
Usher syndrome 1G homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2450757]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16399 Nonsense Available for shipment Available now
sa10814 Nonsense Available for shipment Available now
sa19046 Nonsense Mutation detected in F1 DNA During 2014
sa24923 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110162 Nonsense 124 488 2 4
Genomic Location:
Chromosome 12 (position 47662323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGAGCCACATGGACTGTGTTCGRTATCTGGACTCRATCGCCGCCAAA[C/T]AAATCACCATTAATCCTAAGTTGGTGAGCAAACTGAAGGAGCGAGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110162 Nonsense 180 488 2 4
ENSDART00000110162 Nonsense 180 488 2 4
Genomic Location:
Chromosome 12 (position 47662493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCATGAGGGAAAGTGCTGCATTGGATACGTCGGATACYATGAGTTA[C/A]AGCAGCTTCAGCAGYACGTTGAGTCRRCGGATGCCTCAGTTTAACACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110162 Nonsense 180 488 2 4
ENSDART00000110162 Nonsense 180 488 2 4
Genomic Location:
Chromosome 12 (position 47662493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATGAGGGAAAGTGCTGCATTGGATACGTCGGATACCATGAGTTA[C/A]AGCAGCTTCAGCAGCACGTTGAGTCGACGGATGCCTCAGTTTAACACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110162 Nonsense 232 488 3 4
Genomic Location:
Chromosome 12 (position 47665340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGATTCAGCGGAAACTTGAGAAGAAGAAGCAAGTTGAAGGAACGTTC[A/T]AGATTTCTGAAGACGGGCGAAAGAGTGTTCGTTCCCTCTCTGGTCTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nbgpa93c