myh7b

Ensembl ID:
ENSDARG00000076075
Human Orthologue:
MYH7B
Human Description:
myosin, heavy chain 7B, cardiac muscle, beta [Source:HGNC Symbol;Acc:15906]
Mouse Orthologue:
Myh7b
Mouse Description:
myosin, heavy chain 7B, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:3710243]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21910 Nonsense Available for shipment Available now
sa12629 Nonsense Available for shipment Available now
sa38843 Nonsense Mutation detected in F1 DNA During 2016
sa8767 Nonsense Mutation detected in F1 DNA During 2016
sa31830 Nonsense Available for shipment Available now
hu7861 Nonsense Available for shipment Available now
sa9233 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 3 1944 1 41
Genomic Location (Zv9):
Chromosome 11 (position 26147198)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24976023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTCAGTCTTCAGTGCGTAAAGCAGCGGTGGATTTATCATCATGTCG[C/T]GAATGTTGGATATGAAGGAGTTTGGAGAAGCTGCTCCGTTTCTGCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 743 1944 21 41
Genomic Location (Zv9):
Chromosome 11 (position 26136410)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24965235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTTCTACAGGTATCGCATTCTGAATCCTCACGCTATTCCCSATGAC[A/T]AGTTTGTGGATAGCAGGAAGGCTGCGGAGAAACTTCTGGCTTCACTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 766 1944 21 41
Genomic Location (Zv9):
Chromosome 11 (position 26136341)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24965166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGCGGAGAAACTTCTGGCTTCACTGGATATTGACCACAATCAATAT[A/T]GATTTGGACATACTAAGGCAAGTCAGACTTTTGCTAGAAAACGTTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 846 1944 23 41
Genomic Location (Zv9):
Chromosome 11 (position 26132867)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24961692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCAACATTGTGAAGAACTGGCCATGGATGAAACTGTTCTTCAAWATC[A/T]AACCCCTGCTGAGGAGYGCAGCCACAGAAAAAGAGCTGGCYGCTCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 1000 1944 25 41
Genomic Location (Zv9):
Chromosome 11 (position 26130326)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24959151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGAAGAATCTGATAGAAGAGATGGCAGCTTTGGATGAAACTATACTG[A/T]AGCTCACCAAAGAGAAAAAAGCCCTACAGGAGAGTCACCAGCAGACCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 1052 1944 26 41
Genomic Location (Zv9):
Chromosome 11 (position 26130077)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24958902
KASP Assay ID:
554-2377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACYATAATGCCTTTGTTTTAGTTGGAGGGCTCCTTAGAACAGGAAAAG[A/T]AATTGCGAATGGATCTGGAACGTTCAAAACGCAAGCTGGAGGGCGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097316 Nonsense 1150 1944 28 41
Genomic Location (Zv9):
Chromosome 11 (position 26128317)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24957142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCGCTCYACCCGAGCCAAAATGGAGAAACATCGAAGYGATTCGTCC[A/T]AAGAGCTTGAAGAGCTCAGTGAGCGTCTCGAAGAAGCCGGAGGAGCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Anticoagulant levels: A genome-wide association study of the Protein C anticoagulant pathway. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link