dda1

Ensembl ID:
ENSDARG00000076074
ZFIN ID:
ZDB-GENE-040426-2137
Description:
DET1- and DDB1-associated protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T2A3]
Human Orthologue:
DDA1
Human Description:
DET1 and DDB1 associated 1 [Source:HGNC Symbol;Acc:28360]
Mouse Orthologue:
Dda1
Mouse Description:
DET1 and DDB1 associated 1 Gene [Source:MGI Symbol;Acc:MGI:1913748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38822 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104369 Essential Splice Site 48 104 3 5
ENSDART00000123601 Essential Splice Site 48 104 3 5
ENSDART00000140960 Essential Splice Site 48 104 4 6
Genomic Location (Zv9):
Chromosome 11 (position 5984544)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5952727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGACCGTCAGTGTATCTGCCTACACGAGAGTATCCCTCTGAACAGAG[T/C]AAGCGGGTTTAAATAAAATGTAGACTCGGATAATAAAACTCAAAGTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link