si:ch211-223m11.1

Ensembl ID:
ENSDARG00000076070
ZFIN ID:
ZDB-GENE-061106-1
Description:
Novel protein similar to human discs, large ( Drosophila ) homolog-associated protein 3 ( DLGAP3 ) [
Human Orthologue:
DLGAP2
Human Description:
discs, large (Drosophila) homolog-associated protein 2 [Source:HGNC Symbol;Acc:2906]
Mouse Orthologue:
Dlgap2
Mouse Description:
discs, large (Drosophila) homolog-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43400 Nonsense Mutation detected in F1 DNA During 2017
sa36993 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082441 Nonsense 173 462 3 7
ENSDART00000132580 Nonsense 140 429 2 6
Genomic Location (Zv9):
Chromosome 20 (position 14074890)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14264136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTAAAGGTCTCCCGCAGTATCATTCTGTGGGCATCCAGGTAGAGGAC[G/T]AGAAGAGGTAAGTTTATTGATCCATTATATACAGTACAGGACATTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082441 Nonsense 289 462 4 7
ENSDART00000132580 Nonsense 256 429 3 6
Genomic Location (Zv9):
Chromosome 20 (position 14073766)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14263012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCCGCGACGGCAGCTGGTTCATGCAGCTTCTGCACAGTGAAACCAAA[C/T]GATTGGAGGGATGGTGTAAAGACATGGAGAGAGAAGCAGAGGAGCACGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link