march6

Ensembl ID:
ENSDARG00000076066
ZFIN ID:
ZDB-GENE-070912-530
Human Orthologue:
MARCH6
Human Description:
membrane-associated ring finger (C3HC4) 6 [Source:HGNC Symbol;Acc:30550]
Mouse Orthologue:
March6
Mouse Description:
membrane-associated ring finger (C3HC4) 6 Gene [Source:MGI Symbol;Acc:MGI:2442773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8085 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115271 Essential Splice Site 486 914 16 26
ENSDART00000137048 None None 238 None 7
ENSDART00000145732 Essential Splice Site 486 911 16 26
Genomic Location:
Chromosome 2 (position 30222443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCMCCTGCCAATATACAGACACCTGAGACGATTCATATTATCTGTGG[T/A]AAGCAAAGGTTGACCTCCTTTCTTTCAGACCTTATCTAAGGAGGCCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: A novel locus for body mass index on 5p15.2: a meta-analysis of two genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u63xehdr