march6

Ensembl ID:
ENSDARG00000076066
ZFIN ID:
ZDB-GENE-070912-530
Human Orthologue:
MARCH6
Human Description:
membrane-associated ring finger (C3HC4) 6 [Source:HGNC Symbol;Acc:30550]
Mouse Orthologue:
March6
Mouse Description:
membrane-associated ring finger (C3HC4) 6 Gene [Source:MGI Symbol;Acc:MGI:2442773]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8085 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32940 Nonsense Mutation detected in F1 DNA During 2016
sa32941 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115271 Essential Splice Site 486 914 16 26
ENSDART00000137048   None 238 None 7
ENSDART00000145732 Essential Splice Site 486 911 16 26
Genomic Location:
Chromosome 2 (position 30222443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCMCCTGCCAATATACAGACACCTGAGACGATTCATATTATCTGTGG[T/A]AAGCAAAGGTTGACCTCCTTTCTTTCAGACCTTATCTAAGGAGGCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115271 Nonsense 527 914 18 26
ENSDART00000137048   None 238 None 7
ENSDART00000145732 Nonsense 527 911 18 26
Genomic Location:
Chromosome 2 (position 30226690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTGTCTCTCTTCTGTCTCTCTTTCAGTGACGCTCCAGTGAGTGAGT[T/A]GTCTCTGGAGCTGCTGTTGTTGCAGGTCGTTCTTCCTGCACTGTTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115271 Nonsense 640 914 20 26
ENSDART00000137048 Nonsense 25 238 2 7
ENSDART00000145732 Nonsense 640 911 20 26
Genomic Location:
Chromosome 2 (position 30228903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAACTGTTTTTCTTCTTTTTCCCCTCTCTAGATTGTCTTGCTGATAT[T/A]GTTCATGTGTGTGACGCTACTTTTGGCCAGTTTAGTGTGTCTTACGTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: A novel locus for body mass index on 5p15.2: a meta-analysis of two genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link